Making choices dna or rna (solution)

Exercise

Write a function that determines if a sequence of base pairs is DNA, RNA, or if it is not possible to tell given the sequence provided. RNA has the base Uracil ("u") instead of the base Thymine ("t"), so sequences with u’s are RNA, sequences with t’s are DNA, and sequences with neither are unknown.

You can check if a string contains a character (or a longer substring) in R using the str_detect function from the stringr package: str_detect(string, substring), which will return TRUE if substring is present in string. So str_detect(sequence, "u") will check if the string in the sequence variable has the base u.

Name the function dna_or_rna() and have it take sequence as an argument. Have the function return one of three outputs: "DNA", "RNA", or "UNKNOWN". Call the function on each of the following sequences.

seq1 <- "ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg"
seq2 <- "gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau"
seq3 <- "gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc"

Challenge (optional): Figure out how to make your function work with both upper and lower case letters, or even strings with mixed capitalization.

Output solution

[1] "DNA"

[1] "RNA"

[1] "UNKNOWN"