Making choices dna or rna iteration (solution)

Exercise

This is a follow-up to DNA or RNA.

Write a function, dna_or_rna(sequence), that determines if a sequence of base pairs is DNA, RNA, or if it is not possible to tell given the sequence provided. Since all the function will know about the material is the sequence the only way to tell the difference between DNA and RNA is that RNA has the base Uracil ("u") instead of the base Thymine ("t"). Have the function return one of three outputs: "DNA", "RNA", or "UNKNOWN".

Copy and paste the following sequence data into your script:

sequences = c("ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg", "gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau", "gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc", "guuuccuacaguauuugaugagaaugagaguuuacuccuggaagauaauauuagaauguuuacaacugcaccugaucagguggauaaggaagaugaagacu", "gauaaggaagaugaagacuuucaggaaucuaauaaaaugcacuccaugaauggauucauguaugggaaucagccggguc")

1. Use the function you wrote and a for loop to create a vector of sequence types for the values in sequences
2. Use the function and a for loop to create a data frame that includes a column of sequences and a column of their types
3. Use the function and sapply to create a vector of sequence types for the values in sequences

Optional: For a little extra challenge make your function work with both upper and lower case letters, or even strings with mixed capitalization

Output solution

[1] "DNA"     "RNA"     "UNKNOWN" "RNA"     "RNA"    

                                                                                              sequences
1                                ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg
2                                gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau
3                                                        gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc
4 guuuccuacaguauuugaugagaaugagaguuuacuccuggaagauaauauuagaauguuuacaacugcaccugaucagguggauaaggaagaugaagacu
5                       gauaaggaagaugaagacuuucaggaaucuaauaaaaugcacuccaugaauggauucauguaugggaaucagccggguc
  sequence_types
1            DNA
2            RNA
3        UNKNOWN
4            RNA
5            RNA

                               ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg 
                                                                                                "DNA" 
                               gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau 
                                                                                                "RNA" 
                                                       gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc 
                                                                                            "UNKNOWN" 
guuuccuacaguauuugaugagaaugagaguuuacuccuggaagauaauauuagaauguuuacaacugcaccugaucagguggauaaggaagaugaagacu 
                                                                                                "RNA" 
                      gauaaggaagaugaagacuuucaggaaucuaauaaaaugcacuccaugaauggauucauguaugggaaucagccggguc 
                                                                                                "RNA"