Strings stringr functions (solution)

Exercise

Output solution

Code solutions for stringr Functions

1. "atgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgc".

[1] "atgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgc"

2. ” Thank goodness it’s Friday” without the leading white space

[1] "Thank goodness it's Friday"

3. "gcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgg" with all of the occurrences of "a" replaced with "A"

[1] "gcAgtctgAggAttccAccttctAcctgggAgAgAggAcAtActAtAtcgcAgcAgtggAggtggAAtgg"

4. Print the length of this dna sequence

[1] 50

5. The number of "a"s in "gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg".

[1] 16

6. Print the first 20 positions of this dna sequence "gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg"

[1] "gccgatgtacatggaatata"

7. Print the last 10 positions of this dna sequence gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg

[1] "tgtggagagg"